common_adapters.fasta 2.33 KB
Newer Older
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54
>PrefixPE_1
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PrefixPE_2
CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
>PCR_Primer1
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PCR_Primer1_rc
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
>PCR_Primer2
CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
>PCR_Primer2_rc
AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG
>FlowCell1
TTTTTTTTTTAATGATACGGCGACCACCGAGATCTACAC
>FlowCell2
TTTTTTTTTTCAAGCAGAAGACGGCATACGA
>TruSeq_Adapter_Index1
GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index2
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index3
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index4
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index5
GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index6
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index7
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index8
GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index9
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index10
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index11
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index12
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index13
GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index14
GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index15
GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index16
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index18
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index19
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index20
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGGCCTTATCTCGTATGCCGTCTTCTGCTTG
55 56 57 58 59 60 61 62
>PE1
TACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PE1_rc
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
>PE2
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
>PE2_rc
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC